Primer Design

DNA Seq (one entry per line pasted from Excel)
Forward / Reverse LIC
Forward:
Reverse:

Please select vector
pMCSG7-compatible (pMCSG9, pMCSG19, pMCSG68, pMCSG73, pRSF2 etc.)
pMCSG28-compatible (pMCSG27, pMCSG28, pMCSG29)
pMCSG26-compatible (pMCSG26, Hsp-vectors)
pMCSG30-compatible  
pMCSG32-compatible  
pMCSG81-compatible  
pMCSG87-compatible  
RBS-fusion Fusion: TAGAATGGTGTTTAACTTTAAGAAGGAGATATACAT
Add ATG to forward primer when needed
Remove TAG (CTCCTTCTTAAAGTTAAACACCATTCTA) when stop codon already present
pMCSG80 extended This is a permanent N-term MBP-fusion with C-term extension (SLSSVKNNIGSG)
Catch - GS Catch GS primers
pMCSG91 (C-term) C-term vector
Desired Tm
Tm:
Maximum Primer Length:
5' TTG (L) or GTG (V):
Finished in 0s